Sequence retrieval

Genome: Escherichia coli UM146
Start position: 4118446
End position: 4118469
Length: 24

DNA sequence
>NC_017632, from 4118446 to 4118469 (24 bp); Escherichia coli UM146 AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4117739-4118773	Sequence	UM146_19765 - rhamnose-proton symporter (Protein is coded in complementary strand; from 4118773 to 4117739)