Sequence retrieval

Genome: Escherichia coli UM146
Start position: 2874123
End position: 2874167
Length: 45

DNA sequence
>NC_017632, from 2874123 to 2874167 (45 bp); Escherichia coli UM146 TCTGCGGCAGCTTTTGCTGCAGCGGCTTTTTCAGCTGCTGCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2873736-2874986	Sequence	UM146_13930 tolA cell envelope integrity inner membrane protein TolA (Protein is coded in complementary strand; from 2874986 to 2873736)