Sequence retrieval

Genome: Escherichia coli UM146
Start position: 2246105
End position: 2246140
Length: 36

DNA sequence
>NC_017632, from 2246105 to 2246140 (36 bp); Escherichia coli UM146 TTCTTGATCTGTATCTTTATCTGTATCTTTATCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2245506-2246576	Sequence	UM146_10725 - hypothetical protein (Protein is coded in complementary strand; from 2246576 to 2245506)