Sequence retrieval

Genome: Escherichia coli UM146
Start position: 2194784
End position: 2194807
Length: 24

DNA sequence
>NC_017632, from 2194784 to 2194807 (24 bp); Escherichia coli UM146 CCACCGCCTCCGCCACCCGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2194775-2196670	Sequence	UM146_10445 - hypothetical protein (Protein is coded in complementary strand; from 2196670 to 2194775)