Sequence retrieval

Genome: Escherichia coli UM146
Start position: 1602588
End position: 1602615
Length: 28

DNA sequence
>NC_017632, from 1602588 to 1602615 (28 bp); Escherichia coli UM146 ACCAGCAACCAGCGACCGGCAGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1602309-1603967	Sequence	UM146_07495 fliF flagellar MS-ring protein (Protein is coded in complementary strand; from 1603967 to 1602309)