Sequence retrieval

Genome: Escherichia coli UM146
Start position: 1008215
End position: 1008238
Length: 24

DNA sequence
>NC_017632, from 1008215 to 1008238 (24 bp); Escherichia coli UM146 TTCCTTTCTTGCTTTCTTCCTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1007887-1008492	Sequence	UM146_04820 - DNA single-strand annealing protein; essential recombination function protein Erf (Protein is coded in complementary strand; from 1008492 to 1007887)