Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC 43143
Start position: 899868
End position: 899894
Length: 27

DNA sequence
>NC_017576, from 899868 to 899894 (27 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC 43143 TTCAAGTTCTTCAAGCTCATCAAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 899135-900196	Sequence	SGGB_0859 - iron complex transport system substrate-binding protein