Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC 43143
Start position: 734322
End position: 734354
Length: 33

DNA sequence
>NC_017576, from 734322 to 734354 (33 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC 43143 AAGAAAAAGGGAAGAAAGAGGAAAGAAAATGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 733596-734324	Sequence	SGGB_0707 - VTC domain-containing protein
ORF... 734351-735016	Sequence	SGGB_0708 - membrane protein