Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC 43143
Start position: 522258
End position: 522287
Length: 30

DNA sequence
>NC_017576, from 522258 to 522287 (30 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC 43143 TTTGATTTTATTTGATGTTGTTTGATTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 522124-522732	Sequence	SGGB_0499 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 522732 to 522124)