Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC 43143
Start position: 2308146
End position: 2308169
Length: 24

DNA sequence
>NC_017576, from 2308146 to 2308169 (24 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC 43143 CAAGACCAAGTCCAAAACCAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2307797-2309074	Sequence	SGGB_2242 hisS histidyl-tRNA synthetase (Protein is coded in complementary strand; from 2309074 to 2307797)