Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC 43143
Start position: 1447101
End position: 1447124
Length: 24

DNA sequence
>NC_017576, from 1447101 to 1447124 (24 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC 43143 AGTTCAAGTTCAAGCTCAAGTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1445581-1447806	Sequence	SGGB_1399 - polar amino acid transport system permease/substrate-binding protein