Sequence retrieval

Genome: Streptococcus gallolyticus subsp. gallolyticus ATCC 43143
Start position: 136388
End position: 136414
Length: 27

DNA sequence
>NC_017576, from 136388 to 136414 (27 bp); Streptococcus gallolyticus subsp. gallolyticus ATCC 43143 GAAACAGAAAAAACAGAAGAAAAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 136254-138578	Sequence	SGGB_0128 pbp2A penicillin-binding protein 2A