Sequence retrieval

Genome: Propionibacterium acnes 6609
Start position: 2038365
End position: 2038400
Length: 36

DNA sequence
>NC_017535, from 2038365 to 2038400 (36 bp); Propionibacterium acnes 6609 GTCGGAGTCGGCGTGGGAGTAGGAGTCGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2038188-2039087	Sequence	TIB1ST10_09605 - putative adhesion or S-layer protein (Protein is coded in complementary strand; from 2039087 to 2038188)