Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 1423767
End position: 1423829
Length: 63

DNA sequence
>NC_017513, from 1423767 to 1423829 (63 bp); Neisseria meningitidis G2136 AGCTGCTTCAGTTACAGCTTCTTTGGCTTCAGTTACAGCTTCTTTGGCTTCAGTTACAGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1423696-1424040	Sequence	NMBG2136_1361 - hypothetical protein (Protein is coded in complementary strand; from 1424040 to 1423696)