Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 1261462
End position: 1261506
Length: 45

DNA sequence
>NC_017513, from 1261462 to 1261506 (45 bp); Neisseria meningitidis G2136 CCTGACGGATACGCTCTTGGCGGATACGTTCTTGGCGGATACGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1260381-1262186	Sequence	NMBG2136_1236 - M23 peptidase domain-containing protein (Protein is coded in complementary strand; from 1262186 to 1260381)