Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 979842
End position: 979877
Length: 36

DNA sequence
>NC_017513, from 979842 to 979877 (36 bp); Neisseria meningitidis G2136 TGTCATTGGTGTTTTCATTGGTGTTTTCATTGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 978431-980227	Sequence	NMBG2136_0971 - hemagglutinin family protein (Protein is coded in complementary strand; from 980227 to 978431)