Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 564426
End position: 564461
Length: 36

DNA sequence
>NC_017513, from 564426 to 564461 (36 bp); Neisseria meningitidis G2136 TTCGTGGTCATGATCGTGGTCATGATCGTGGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 563884-564810	Sequence	NMBG2136_0524 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 564810 to 563884)