Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 375754
End position: 375789
Length: 36

DNA sequence
>NC_017513, from 375754 to 375789 (36 bp); Neisseria meningitidis G2136 GCTATTATTGCTATTATTGCTATTCTTGCCATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 374597-377500	Sequence	NMBG2136_0370 - type IV pilus assembly protein PilC (Protein is coded in complementary strand; from 377500 to 374597)