Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 1834416
End position: 1834451
Length: 36

DNA sequence
>NC_017513, from 1834416 to 1834451 (36 bp); Neisseria meningitidis G2136 GGGTAGCGGGGGTAGCGGGGGTAGCGGGGGTAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1833428-1834465	Sequence	NMBG2136_1714 - aldose 1-epimerase (Protein is coded in complementary strand; from 1834465 to 1833428)