Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 1500877
End position: 1500903
Length: 27

DNA sequence
>NC_017513, from 1500877 to 1500903 (27 bp); Neisseria meningitidis G2136 CTTCTTCGGTTTCTTCGGCTTCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1500237-1502471	Sequence	NMBG2136_1422 - lactoferrin-binding protein B (Protein is coded in complementary strand; from 1502471 to 1500237)