Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 1258780
End position: 1258806
Length: 27

DNA sequence
>NC_017513, from 1258780 to 1258806 (27 bp); Neisseria meningitidis G2136 TTCTTATCTTTTTTATCTTTCTTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1258777-1260261	Sequence	NMBG2136_1235 - carboxy-terminal processing protease (Protein is coded in complementary strand; from 1260261 to 1258777)