Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 550195
End position: 550218
Length: 24

DNA sequence
>NC_017513, from 550195 to 550218 (24 bp); Neisseria meningitidis G2136 ACGGCGACGGCTTCGGCGACAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 549472-550491	Sequence	NMBG2136_0514 - copper ABC transporter periplasmic copper-binding protein