Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 401849
End position: 401872
Length: 24

DNA sequence
>NC_017513, from 401849 to 401872 (24 bp); Neisseria meningitidis G2136 CCGTCGCCGCCGCCGTAGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 401558-404992	Sequence	NMBG2136_0389 - DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 404992 to 401558)