Sequence retrieval

Genome: Neisseria meningitidis G2136
Start position: 1064580
End position: 1064603
Length: 24

DNA sequence
>NC_017513, from 1064580 to 1064603 (24 bp); Neisseria meningitidis G2136 GCCGAAGCCGTAGTCGAAGCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1062982-1064844	Sequence	NMBG2136_1057 hscA Fe-S protein assembly chaperone HscA