Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 1578946
End position: 1578990
Length: 45

DNA sequence
>NC_017512, from 1578946 to 1578990 (45 bp); Neisseria meningitidis WUE 2594 CAGCTCCTGCTGCTTCCGCTCCCGCAGCTTCTGCTCCTGCAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1577845-1579017	Sequence	NMAA_1353 aniA copper-containing nitrite reductase (major outer-membrane protein Pan1)