Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 546603
End position: 546638
Length: 36

DNA sequence
>NC_017512, from 546603 to 546638 (36 bp); Neisseria meningitidis WUE 2594 TTCGTGGTCATGGTCGTGGTCATGATCGTGGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 546061-546987	Sequence	NMAA_0439 - putative ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 546987 to 546061)