Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 1858568
End position: 1858603
Length: 36

DNA sequence
>NC_017512, from 1858568 to 1858603 (36 bp); Neisseria meningitidis WUE 2594 GCCGCTACCGTTGCCGCTACCGTTGCCGTTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1858494-1858649	Sequence	NMAA_1591 - hypothetical protein (Protein is coded in complementary strand; from 1858649 to 1858494)