Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 607243
End position: 607269
Length: 27

DNA sequence
>NC_017512, from 607243 to 607269 (27 bp); Neisseria meningitidis WUE 2594 GGGTGAAGAGGATGAAGACGGTGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 607224-608681	Sequence	NMAA_0497 - putative Trk system potassium uptake protein (Protein is coded in complementary strand; from 608681 to 607224)