Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 1219725
End position: 1219751
Length: 27

DNA sequence
>NC_017512, from 1219725 to 1219751 (27 bp); Neisseria meningitidis WUE 2594 TTCTTATCTTTTTTATCTTTCTTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1219722-1221206	Sequence	NMAA_1062 prc carboxy-terminal processing protease (C-terminal processing protease) (Protein is coded in complementary strand; from 1221206 to 1219722)