Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 638581
End position: 638604
Length: 24

DNA sequence
>NC_017512, from 638581 to 638604 (24 bp); Neisseria meningitidis WUE 2594 TTTGGCTTTGGGCTTGGCTTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 638129-639127	Sequence	NMAA_0529 tpc tetrapac protein (Protein is coded in complementary strand; from 639127 to 638129)