Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 594701
End position: 594724
Length: 24

DNA sequence
>NC_017512, from 594701 to 594724 (24 bp); Neisseria meningitidis WUE 2594 GCGAGGGCGCGGGCGAGGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 594104-595162	Sequence	NMAA_0482 fbpC iron(III)-transport system ATP-binding protein FbpC (ferric cations import ATP-binding protein FbpC) (Protein is coded in complementary strand; from 595162 to 594104)