Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 501510
End position: 501533
Length: 24

DNA sequence
>NC_017512, from 501510 to 501533 (24 bp); Neisseria meningitidis WUE 2594 CTTTGCCTGTGCCTTTGTCTTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 501071-502999	Sequence	NMAA_0397 dnaK chaperone protein DnaK (heat shock protein 70; heat shock 70 kDa protein; HSP70) (Protein is coded in complementary strand; from 502999 to 501071)