Sequence retrieval

Genome: Neisseria meningitidis WUE 2594
Start position: 380827
End position: 380850
Length: 24

DNA sequence
>NC_017512, from 380827 to 380850 (24 bp); Neisseria meningitidis WUE 2594 CCGTCGCCGCCGCCGTAGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 380536-383970	Sequence	NMAA_0316 dnaE DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 383970 to 380536)