Sequence retrieval

Genome: Neisseria meningitidis 8013
Start position: 288408
End position: 288443
Length: 36

DNA sequence
>NC_017501, from 288408 to 288443 (36 bp); Neisseria meningitidis 8013 GCCAAAGCTGCCAAAGCTGCCAAAGCTGCCAAAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 288319-289383	Sequence	NMV_0307 - putative peptidylprolyl isomerase (peptidyl-prolyl cis-trans isomerase; PPIase; rotamase; cyclophilin; FKBP65)