Sequence retrieval

Genome: Neisseria meningitidis 8013
Start position: 1280629
End position: 1280667
Length: 39

DNA sequence
>NC_017501, from 1280629 to 1280667 (39 bp); Neisseria meningitidis 8013 TCTCTACAACCCATCTCTACAACCCATCTCTACAACCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1280646-1281017	Sequence	NMV_1273 - hypothetical protein (Protein is coded in complementary strand; from 1281017 to 1280646)