Sequence retrieval

Genome: Neisseria meningitidis 8013
Start position: 1125084
End position: 1125119
Length: 36

DNA sequence
>NC_017501, from 1125084 to 1125119 (36 bp); Neisseria meningitidis 8013 TGGGAGAGGGCTAGGGAGAGGGCTAGGGAGAGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1122571-1126710	Sequence	NMV_1115 mfd transcription-repair coupling factor (Protein is coded in complementary strand; from 1126710 to 1122571)