Sequence retrieval

Genome: Lactobacillus fermentum CECT 5716
Start position: 985237
End position: 985260
Length: 24

DNA sequence
>NC_017465, from 985237 to 985260 (24 bp); Lactobacillus fermentum CECT 5716 CCTGGCCGTGGCCATGGCCGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 984801-985784	Sequence	LC40_0551 - Phosphate starvation-inducible protein PhoH