Sequence retrieval

Genome: Lactobacillus fermentum CECT 5716
Start position: 886752
End position: 886775
Length: 24

DNA sequence
>NC_017465, from 886752 to 886775 (24 bp); Lactobacillus fermentum CECT 5716 GACGCCGAAGCCAACGCCGAAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 885283-887139	Sequence	LC40_0507 - Chaperone protein dnaK (Heat shock protein 70) (Heat shock 70 kDa protein) (HSP70)