Sequence retrieval

Genome: Lactobacillus fermentum CECT 5716
Start position: 1341382
End position: 1341405
Length: 24

DNA sequence
>NC_017465, from 1341382 to 1341405 (24 bp); Lactobacillus fermentum CECT 5716 GGGTTGGGGTAGGGCTTGGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1340800-1341531	Sequence	LC40_0757 - Carbamoyl-phosphate synthase (Glutamine-hydrolyzing) (Protein is coded in complementary strand; from 1341531 to 1340800)