Sequence retrieval

Genome: Lactobacillus fermentum CECT 5716
Start position: 1128959
End position: 1128982
Length: 24

DNA sequence
>NC_017465, from 1128959 to 1128982 (24 bp); Lactobacillus fermentum CECT 5716 TGATCGTGGTCGTGTTCGTGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1128244-1129155	Sequence	LC40_0633 - cysteine synthase (Protein is coded in complementary strand; from 1129155 to 1128244)