Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 817832
End position: 817876
Length: 45

DNA sequence
>NC_017445, from 817832 to 817876 (45 bp); Erwinia sp. Ejp617 GCGCCTCCGCTGATGATGCCTCCGCTAATGGCTCCTCTGCTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 814447-818910	Sequence	EJP617_07540 - hypothetical protein (Protein is coded in complementary strand; from 818910 to 814447)