Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 681773
End position: 681799
Length: 27

DNA sequence
>NC_017445, from 681773 to 681799 (27 bp); Erwinia sp. Ejp617 CCGCCCATGCCGCCCATACCACCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 681764-683413	Sequence	EJP617_06200 groL molecular chaperone GroEL (Protein is coded in complementary strand; from 683413 to 681764)