Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 521893
End position: 521916
Length: 24

DNA sequence
>NC_017445, from 521893 to 521916 (24 bp); Erwinia sp. Ejp617 AATTAAAAGTAAAATAAAATTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 521126-521923	Sequence	EJP617_04730 - hypothetical protein (Protein is coded in complementary strand; from 521923 to 521126)