Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 476468
End position: 476503
Length: 36

DNA sequence
>NC_017445, from 476468 to 476503 (36 bp); Erwinia sp. Ejp617 TGGTGAATAGATTTATGAATAGATTTGTGAATAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 475138-476469	Sequence	EJP617_04310 yjjJ hypothetical protein (Protein is coded in complementary strand; from 476469 to 475138)