Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 3784184
End position: 3784207
Length: 24

DNA sequence
>NC_017445, from 3784184 to 3784207 (24 bp); Erwinia sp. Ejp617 AGCGGCAGGGGCAGCAGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3783788-3784447	Sequence	EJP617_34990 ccmB Heme exporter protein B (Protein is coded in complementary strand; from 3784447 to 3783788)