Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 368427
End position: 368450
Length: 24

DNA sequence
>NC_017445, from 368427 to 368450 (24 bp); Erwinia sp. Ejp617 GCCGCTGCCCCTGCTGCTGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 367808-368596	Sequence	EJP617_03390 outO Type IV-A prepilin peptidase PilD