Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 3287975
End position: 3287998
Length: 24

DNA sequence
>NC_017445, from 3287975 to 3287998 (24 bp); Erwinia sp. Ejp617 GGTTTTGGCTTTGGTTTGGGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3287570-3288385	Sequence	EJP617_30310 tonB transporter (Protein is coded in complementary strand; from 3288385 to 3287570)