Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2644171
End position: 2644200
Length: 30

DNA sequence
>NC_017445, from 2644171 to 2644200 (30 bp); Erwinia sp. Ejp617 ACCAGCGCCAGCACCAGGGCCAGCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2643595-2644266	Sequence	EJP617_24180 artM arginine transporter permease subunit ArtM (Protein is coded in complementary strand; from 2644266 to 2643595)