Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 2594970
End position: 2594993
Length: 24

DNA sequence
>NC_017445, from 2594970 to 2594993 (24 bp); Erwinia sp. Ejp617 CGGCAACGGCAGCAGCAACGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2594207-2595757	Sequence	EJP617_23720 hutH histidine ammonia-lyase (Protein is coded in complementary strand; from 2595757 to 2594207)