Sequence retrieval

Genome: Erwinia sp. Ejp617
Start position: 246691
End position: 246717
Length: 27

DNA sequence
>NC_017445, from 246691 to 246717 (27 bp); Erwinia sp. Ejp617 AACTGCTGGAACTGCTGAAACTGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 245479-246927	Sequence	EJP617_02240 - serine endoprotease (Protein is coded in complementary strand; from 246927 to 245479)